Evaluation of protamine 2 genes in spermatozoa of teratospermic and oligospermic men in Nigeria

There have been several reports of single nucleotide polymorphisms (SNPs) linked to different kinds of male infertility. The aim of the study was to evaluate single nucleotide polymorphisms in protamine 2 gene (PRM2) in spermatozoa of teratospermic and oligospermic infertile men in Nigeria. At some fertility clinics in Lagos, Nigeria, twenty-two (22) teratospermic and thirty-five (35) oligospermic infertile men as well as thirty (35) normospermic fertile men (control) who volunteered and gave consent were recruited for the cross-section study after meeting the inclusion criteria and confirmation of their fertility statuses by the use of computer-Assisted Sperm Analyzer (CASA). Semen was collected from the participants under the WHO guideline for semen collection and processing. Spermatozoa’s DNA was extracted with the use of Proteinase K Storage Buffer. Nanodrop 1000 spectrophotometer was used to quantify the isolated genomic DNA. PRM II F: 5-AGGGCCCTGCTAGTTGTGA-3' and PRM II R: 3'- CAGATCTTGTGGGCTTCTCG -5, were used as primers. Sequencing of sperm DNA was done using the BigDye Terminator kit on a 3510 ABI sequencer by Inqaba Biotechnological, Pretoria South Africa. Agarose gel electrophoresis was used to show the amplified PRM2. In the study, 7 SNPs in the teratospermic infertile men, 8 SNPs in the oligospermic infertile men and 7 SNPs in the normospermic fertile men were discovered. The SNPs between the teratospermic infertile men and the oligospermic infertile men are significantly different. We propose that considerably larger genome-wide investigations are required to confidently validate these SNPs and find new SNPs linked with male infertility.